View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_high_19 (Length: 301)
Name: NF14706_high_19
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 5e-53; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 135 - 298
Target Start/End: Original strand, 49522337 - 49522488
Alignment:
| Q |
135 |
attgtttcagggaaacgtacgtacgtatatagcaacgagtaatcgtcagcagtgaactgaggagtctcatgaaagccttcaaagccttctagattgttct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
49522337 |
attgtttcagggaaacgtacgtacgtatatagcaacgagtaatcgtcagcagtgaactgag---tctcatgaaag---------ccttctagattattct |
49522424 |
T |
 |
| Q |
235 |
tgagtttcttgataccttgctggataaaaccccatccttcttcaaagttgatattcttcgacat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
49522425 |
tgagtttcttgataccttgctggataaaaccccatccttcttcaaagttgataatctttgacat |
49522488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 49522220 - 49522270
Alignment:
| Q |
19 |
catggaatagtcatgaggaagcttttgactgcacatacggtagatggttct |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49522220 |
catggaatagtcatgaggaagcttttgactgcacatacggtagatggttct |
49522270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 287
Target Start/End: Original strand, 49532746 - 49532818
Alignment:
| Q |
215 |
aaagccttctagattgttcttgagtttcttgataccttgctggataaaaccccatccttcttcaaagttgata |
287 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||| || | ||| |||| || |||||||| ||||||||||||| |
|
|
| T |
49532746 |
aaagccttctagaatgttctggagcttcttgattcccttctgcataatactccatccttgttcaaagttgata |
49532818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University