View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_high_23 (Length: 267)
Name: NF14706_high_23
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 25 - 250
Target Start/End: Original strand, 15509086 - 15509310
Alignment:
| Q |
25 |
cgtagttaaggctttgtacgatgttattgatgatatccacgacttaggctctttagatatgctatgagactaatcattgacctgtcggcaggactttttg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15509086 |
cgtagttaaggctttgtacgatgttattgatgatatccacgacttaggctctttagatatgctatgagactaatcattgacctgtcggcaggacttttt- |
15509184 |
T |
 |
| Q |
125 |
ttttattatgctccacacgagttaggttagctcccaaatgggcaactttaggaatcaaactcggtttcnnnnnnnatgagagagttgttttatactgacc |
224 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15509185 |
ttttattatcctccacacgagttaggttagctcccaaatgggcaagtttaggaatcaaactcggtttctttttttatgagagagttgttttatactgacc |
15509284 |
T |
 |
| Q |
225 |
ttctcgataccatgttggttgtattg |
250 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
15509285 |
ttctcgataccatgttggttatattg |
15509310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University