View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_high_24 (Length: 256)
Name: NF14706_high_24
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 238
Target Start/End: Original strand, 14819642 - 14819871
Alignment:
| Q |
4 |
gtgagatgaattgggtgaaaaattccacttagtatgtgatgtggcaatatattaaaatctaaaaccacttaggtgattttcttcttccaaaaaatcacca |
103 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14819642 |
gtgagctgaattgggtgaaaaattccacttagtatgtgatgtggcaatatattaa--tctaaaaccacttaggtgattttcttcttccaaaaaatcacca |
14819739 |
T |
|
| Q |
104 |
attttagctaggattcatcattttcaaaatttagtcatggaatatgcaatacatccctcctcgctgttctctttttcttttgagaaactttgaggttgct |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
14819740 |
attttagctaggattcgtcattttcaaaatttagtcatggaatatgcaatacatc---cctcgctgttctctttttcttttgataaagtttgaggttgct |
14819836 |
T |
|
| Q |
204 |
attattttatgagtgatgataacttagtgctcact |
238 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| |
|
|
| T |
14819837 |
attattttatgagtaatgataacttggtgctcact |
14819871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University