View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_high_30 (Length: 236)
Name: NF14706_high_30
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_high_30 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 236
Target Start/End: Original strand, 7163366 - 7163587
Alignment:
| Q |
15 |
agatgcaacaacaatttcaagagtttaagaattgttccaacaatttgtcatctcaactgaataatagtggtggaattcaaaaattgatgcatcaaatcta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
7163366 |
agatgcaacaacaatttcaagagtttaagaattgttccaacagtttgtcatcacaactgaataatagtggtggaatttataaattgatgcatcaaatcta |
7163465 |
T |
 |
| Q |
115 |
gttgaacattcatccaattttaacaagcattgaccatatcattatatgcaccattgcagacaccaaaatttaatcaccatttcacacttttagtttggca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7163466 |
gttgaacattcatccaattttaacaagcattaactatatcattatatgcaccattgcagacaccaaaatttaatcaccatttcacacttttagtttggca |
7163565 |
T |
 |
| Q |
215 |
cttctctcatctatcacatttc |
236 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7163566 |
cttctctcatctatcacatttc |
7163587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University