View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_high_4 (Length: 447)
Name: NF14706_high_4
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 20 - 433
Target Start/End: Complemental strand, 31367322 - 31366913
Alignment:
| Q |
20 |
tacttttacagttttttatgtactttttgtgtgaattaattagatatcattcacaaggaactataaagattgatctttcgagttgagtaagataatgtct |
119 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| |||||| ||| |||| ||||| |||||||||||||||||||||||||||||||| | | |
|
|
| T |
31367322 |
tacttttacagtcttttatgta-tttttgtgtgaatta----gatatctttcgcaagcaactacaaagattgatctttcgagttgagtaagataatattt |
31367228 |
T |
 |
| Q |
120 |
ttttaatatattgatttgcctttcnnnnnnnnnnnnnttgacaaaggtaaacctttaccatttttaataaaaacaggaatgttcaccgttggactgggaa |
219 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31367227 |
ttttaatatattgatttgcctttcaaaaataaaaaaattggcaaaggtaaacctttaccatttttaataaaaacaggaatgttcaccgttggactgggaa |
31367128 |
T |
 |
| Q |
220 |
catattagacaatctctgataaataaatactacaaaataacttttaattttcttaaagatatcaacgtaattgctcaattattaaatgacaactcaattt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31367127 |
catattagacaatctctgataaataaatactacaaaataacttttaattttcttaaagatatcaacgtaattgctcaattattaaatgacaactcaattt |
31367028 |
T |
 |
| Q |
320 |
atgaatgatcttttttctttcttgaaaaa-ctttatgaatggtcttgggaacctttctcaatgtatttttaggtttaggttgtgactctggattttatct |
418 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31367027 |
atgaatgatcttttttctttcttgaaaaagctttatgaatggtcttgggaaccttgctcaatgtatttttaggtttaggttgtgactctggattttatct |
31366928 |
T |
 |
| Q |
419 |
ttcggttcccctatg |
433 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
31366927 |
tccggttcccctatg |
31366913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University