View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_low_12 (Length: 350)
Name: NF14706_low_12
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 41 - 327
Target Start/End: Complemental strand, 4050636 - 4050351
Alignment:
| Q |
41 |
tcctctcgcagctataccccacgcctcacacaacaggtagcagcatacttcccacaagactttaaactgatggtgatgtcaatttaatcatcaaccatct |
140 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4050636 |
tcctctcgcagctataccccatgcctcacacaacaggtagcagcacacttcccagaagactttaaactgatggtgatgtcaatttaatcatcaaccatct |
4050537 |
T |
 |
| Q |
141 |
tactatttgcccttccctccaactacatttgttgtctcacaatttttcatcttttacctcttttaccacaatttttaatcataacctcttcaactccaaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
4050536 |
tactatttgcccttccctccaactacatttgttgtctcacaatttttcctcttttacctcttttaccacaagtttttatcataacttcttcaactccaaa |
4050437 |
T |
 |
| Q |
241 |
gtgtgcttacgcgtcctcttaaagattcccttgctctcacataaatcataacacccaaggacttcttagttgtacaactttgatgcc |
327 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4050436 |
gtgtgcttatgcgt-ctcttaaagattcccttgctctcacataaatcataacacccaaggacttcatagttgtacaactttgatgcc |
4050351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University