View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_low_19 (Length: 308)
Name: NF14706_low_19
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 276
Target Start/End: Complemental strand, 38453924 - 38453672
Alignment:
| Q |
19 |
cctatctataatggcatggatgattgctctaa----gtaaggaaattcatatgcaggaaaatggaattcataaaagggaaaaataaaagttttggaaatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38453924 |
cctatctataatggcatggatgattgctctaattaagtaaggaaattcatatgcaggaaaatggaattcataaaagggaaaaataaaagttttggaaatt |
38453825 |
T |
|
| Q |
115 |
ttatttgatgtattgatctaatttattttcttttcggtggaaataaaatgctcaagaaaacaacatatcaattattttatattgagtgattgggggatga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38453824 |
ttatttgatgtattgatctaatttattttgttttcggtggaaataaaatgctcaagaaaacaacatatc---------atattgagtgattgggggatga |
38453734 |
T |
|
| Q |
215 |
attttttccctcgttttgttccttaactttctttgttatttttcctctttatcaaaaagagg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38453733 |
attttttccctcgttttgttccttaactttctttgttatttttcctctttatcaaaaagagg |
38453672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University