View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_low_26 (Length: 255)
Name: NF14706_low_26
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 24 - 145
Target Start/End: Original strand, 48069386 - 48069507
Alignment:
| Q |
24 |
ctcaacaaaattaaatgtctttttgtaaaattgtcacaacatgtagcatcattatagctcaaactttccatacaacaaattattggccgttgtcattctc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48069386 |
ctcaacaaaattaaatgtctttttgtaaaattgtcacaacatgtagcatcattatagctcaaactttccatacaacaaattattggccgttgtcattctc |
48069485 |
T |
|
| Q |
124 |
aatttcaactaccaaccagatt |
145 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48069486 |
aatttcaactaccaaccagatt |
48069507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 48069531 - 48069580
Alignment:
| Q |
158 |
caaaataactacataacactaggtatcaattaattgtcactaacaatagtct |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48069531 |
caaaataactacataac--taggtatcaattaattgtcactaacaatagtct |
48069580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University