View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_low_32 (Length: 237)
Name: NF14706_low_32
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 221
Target Start/End: Original strand, 7417437 - 7417644
Alignment:
| Q |
14 |
tacttaatggtttgtttcaactcaaactcaaataattattcaaatagatatatagatagagagaaataggtacgtctctttaggatcttggaggtgggaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7417437 |
tacttaatggtttgtttcaactcaaactcaaataattattcaaatagatatatagatagagagaaataggtacgtctctttaggatcttggaggtgggaa |
7417536 |
T |
 |
| Q |
114 |
gaattgcgtaccagccatgaaagcattaagaggagctggatatagtgaagaatactcaaatggattgttaacatttgttgtggtggttgttatgagattt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7417537 |
gaattgcgtaccagccatgaaagcattaagaggagctggatatagtgaagaatactcaaatggattgttaacatttgttgttgtggttgttatgagattt |
7417636 |
T |
 |
| Q |
214 |
tgttgatt |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
7417637 |
tgttgatt |
7417644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University