View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14706_low_41 (Length: 204)
Name: NF14706_low_41
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14706_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 39536131 - 39536308
Alignment:
| Q |
16 |
atgaaattaattttatctatttggtggttcattcctacaattgctagtt-----gacagaatgacaaaaatgaatgatgttttttatttggagtattttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39536131 |
atgaaattaattttatctatttggtggttcattcctacaattgctagttgagttgacagaatgacaaaaatgaatgatgttttttatttggagtattttt |
39536230 |
T |
|
| Q |
111 |
tgattgataattggcctttcatgggagagtaacataacttagatttatacttgaatattgagaaagctacatgtttaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39536231 |
tgattgataattggcctttcatgggagagtaaaataacttagatttatacttgaatattgagaaagctacatgtttaa |
39536308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University