View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14707_low_10 (Length: 251)
Name: NF14707_low_10
Description: NF14707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14707_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 5688818 - 5688593
Alignment:
| Q |
18 |
atgagaatatgtgtagagctctcaaaatgggttatctaaccttaaacagatcggccttaacaacctttatcgcgttaggccaaaaagttctttcaagtat |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5688818 |
atgagattatgtgtagagctctcaaaatgggttatctaaccttaaagagatcggccctaacaacctttatcgctttaggccaaaaagttctttcaagtac |
5688719 |
T |
|
| Q |
118 |
gagctataaaaatactatatgaagtcggccctatgtatgagttgttgattaaaaaggtaagaccttatttannnnnnngaaaatattataaagactctca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5688718 |
gagctataaaaatactatatgaagtcggccctatgtatgagttgttgattaaaaaggtaagaccttatttatttttttgaaaatattataaagactctca |
5688619 |
T |
|
| Q |
218 |
caaaatttcttataaacattattttg |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5688618 |
caaaatttcttataaacattattttg |
5688593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University