View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14707_low_11 (Length: 240)
Name: NF14707_low_11
Description: NF14707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14707_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 34 - 171
Target Start/End: Complemental strand, 28837987 - 28837850
Alignment:
| Q |
34 |
ttgtttttagaggaaaaaggtgaaaagtgaaaggatagtggaagagttgtcgttttggatcacagcaagcaaacgatggatttgtgctgtcgtacagtgg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28837987 |
ttgtttttagaggaaaaaggtgaaaagtgaaaggatagtggaagagttgtcgttttggatcacagcaagcaaacgatggatttgtgctgtcgtacagtgg |
28837888 |
T |
 |
| Q |
134 |
tctcttgattctcaaatttcaacaatattcattctatc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28837887 |
tctcttgattctcaaatttcaacaatattcattctatc |
28837850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 168 - 240
Target Start/End: Complemental strand, 28837821 - 28837751
Alignment:
| Q |
168 |
tatcgatcaattagttaattattattactcccaccatccctaaaaaagtattatctatataatttgttacttt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28837821 |
tatcgatcaattagttaattattattactcccaccatccctaaaaaagtattatc--tataatttgttacttt |
28837751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University