View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14707_low_2 (Length: 439)
Name: NF14707_low_2
Description: NF14707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14707_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 2e-87; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 260 - 423
Target Start/End: Complemental strand, 38571238 - 38571075
Alignment:
| Q |
260 |
tatgattgtattgaaacaaagtatttttgtgtgtttgcctctagattgagaacaatgactttctctcttccaagaatggtggaaggatatgaaagaagag |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38571238 |
tatgattgtattgaaacaaagtatttttgtgtgtttgcctctagattgagaacaatgactttctctcttccaagaatggtggaaggatatgaaagaagag |
38571139 |
T |
|
| Q |
360 |
gatccattatacgaagatctcttgcatgaatttcaaccaaacgcataatagcatacttatccac |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38571138 |
gatccattatacgaagatctcttgcatgaatttcaaccaaacgcataatagcatacttatccac |
38571075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 130 - 210
Target Start/End: Complemental strand, 38571366 - 38571286
Alignment:
| Q |
130 |
gtcacttaaagataccctaatatttcatattaagatactatactaacctcttcagcagtgattatagcttttatgtgctgc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38571366 |
gtcacttaaagataccctaatatttcatattaagatactatactaacctcttcagcagtgattatagcttttatgtgctgc |
38571286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 10 - 47
Target Start/End: Complemental strand, 38571472 - 38571435
Alignment:
| Q |
10 |
acatcatcatccattgggtctctaaccaatacctataa |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38571472 |
acatcatcatccattgggtctctaaccaatacctataa |
38571435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University