View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14708_high_5 (Length: 282)
Name: NF14708_high_5
Description: NF14708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14708_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 17 - 274
Target Start/End: Complemental strand, 7148098 - 7147829
Alignment:
| Q |
17 |
cacatcaaagaaaccaaagaaagaacaaaaggtttaaagaaacgagtgttagtgtgagttagaagaaaaacagaaaatggcaacactttctttcaacttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7148098 |
cacatcaaagaaaccaaagaaagaacaaaaggtttaacgaaacgagtgttagtgtgagttagaagaaaaacagaaaatggcaatactttctttcaacttt |
7147999 |
T |
|
| Q |
117 |
tcagtgcaatcagagagatcaagcttcttcccagctgtgcttccatcatcgtcttcttctttatctcaaatttcctgccctagaatttccacgtcccatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7147998 |
tcagtgcaatcagagagatcaagcttcttcccagctgtgcttccatcatcgtcttcttctttatctcaaatttcctgccctagaatttccacgtcccatt |
7147899 |
T |
|
| Q |
217 |
ttcccctca------------atgtcacttccattgaatcagcttctgtcgtgggtaaattcttcatctc |
274 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7147898 |
ttcccctcaaaatatcgtgccatgtcacttccattgaatcagcttctgtcgtgggtaaattcttcatctc |
7147829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University