View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14708_low_10 (Length: 227)
Name: NF14708_low_10
Description: NF14708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14708_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 15 - 148
Target Start/End: Original strand, 38758659 - 38758791
Alignment:
| Q |
15 |
tcattaatgaagtgatttaattaatgtcccaacactctgcttctacgtgcacaattttgtctgtatcggctggctaaagacaaaataatgaagagtgttt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
38758659 |
tcattaatgaagtgatttaattaatgtccca-cactctgcttctgcgtgcacaattttgtctgtatcggctggcaaaagacagaataatgaagagtgttt |
38758757 |
T |
 |
| Q |
115 |
tttgagagaaaaaataatgaagagttaaatatat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38758758 |
tttgagagaaaaaataatgaagagttaaatatat |
38758791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 161 - 216
Target Start/End: Original strand, 38758785 - 38758840
Alignment:
| Q |
161 |
aatatatcaatttttggtcaccctaaattttttattacaaattttagcctttgctt |
216 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
38758785 |
aatatatcaatttttggtctctctaaattttttattacaaattttagcctttgctt |
38758840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University