View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14709_low_13 (Length: 262)
Name: NF14709_low_13
Description: NF14709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14709_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 24946814 - 24946600
Alignment:
| Q |
1 |
ttaaaacacttgatagttatcgacctttggtcttttttcctaatttgacttttcatccatattcgaatgaccctattcccatcagaacttttttcaaa-c |
99 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| ||||| ||||||| | |
|
|
| T |
24946814 |
ttaaaacacttgttagtaatcgacctttggtcttttttcctaatttgacttttcattcatatttgaatggccctattcccatcataacttgtttcaaaac |
24946715 |
T |
 |
| Q |
100 |
cctggtttctgtctttgtcagtgtattcaaaattcattaatcgtgaatttcttggactacagtcttttcagtggttatctgaatatgaattggaattgaa |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| | |
|
|
| T |
24946714 |
cctggtttctgtctctgtcagtgtattcaaaattcattaatcgtgaatttcttggactacagtcttttcagtggttatctgaatattaatcggaattgga |
24946615 |
T |
 |
| Q |
200 |
tgttctgatttgaaa |
214 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
24946614 |
tgtcctgatttgaaa |
24946600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University