View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1470_high_16 (Length: 209)
Name: NF1470_high_16
Description: NF1470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1470_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 14 - 191
Target Start/End: Complemental strand, 40311662 - 40311484
Alignment:
| Q |
14 |
atgaactttgaggcaattgaggaattccctttcagttgtaaattgtaataacctaagtagctccgacacttttgtccggctacacattaac-acatgtta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
40311662 |
atgaactttgaggcaattgaggaattccctttcagttgtaaattgtaataacctaagtagctccgacacttttgtccggctacacactaacggcatgtta |
40311563 |
T |
|
| Q |
113 |
ttacattcggcgtttgtgtccctgttagggcttcataggtaaaaactgtattgcataccctttcagcaaggctgtggct |
191 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311562 |
ttacattcggcgtttgtgtccgtgttagggcttcataggtaaaaactgtattgcataccctttcagcaaggctgtggct |
40311484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University