View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1470_low_20 (Length: 251)
Name: NF1470_low_20
Description: NF1470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1470_low_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 3013781 - 3014018
Alignment:
| Q |
14 |
agaagatgaataaaggtaatggtaactaaaatcgattgattattattattatgcttgaattttgtgtaattattcaagacaacatgtttgaattttgctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3013781 |
agaagatgaataaaggtaatggtaactaaaatcgattgattattattattatgcttgaattttgtgtaattattcaagacaacatgttcgaattttgctt |
3013880 |
T |
|
| Q |
114 |
gatgctgctttaatatcaataataaacttcgaggtttttgttttgctttgattttccaggtgatactgttaagccaccgagtaatcggaaacctgtttct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3013881 |
gatgctgctttaatatcaataataaacttcgaggtttttgttttgctttgattttccaggtgatactgttaagccaccgagtaatcggaaacctgtttct |
3013980 |
T |
|
| Q |
214 |
tgcatcataggtgatgcgtacactggcaaaaccacgct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3013981 |
tgcatcataggtgatgcgtacactggcaaaaccacgct |
3014018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 166 - 247
Target Start/End: Complemental strand, 40672775 - 40672688
Alignment:
| Q |
166 |
tttccaggtgatactgttaagccaccg------agtaatcggaaacctgtttcttgcatcataggtgatgcgtacactggcaaaacca |
247 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| |||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
40672775 |
tttccaggtgatactgttaagccgccgccgcctagttatcggaaacctgtttcctgcatcataggtgatgcatacactggcaaaacca |
40672688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 14 - 77
Target Start/End: Complemental strand, 40672856 - 40672796
Alignment:
| Q |
14 |
agaagatgaataaaggtaatggtaactaaaatcgattgattattattattatgcttgaattttg |
77 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40672856 |
agaagatgaatgaaggtaatgataactaaaatcgattgattatta---ttatgcttgaattttg |
40672796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University