View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1470_low_26 (Length: 243)
Name: NF1470_low_26
Description: NF1470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1470_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 102 - 232
Target Start/End: Complemental strand, 20868318 - 20868188
Alignment:
| Q |
102 |
gaaaagaagaaaacaaaggaggaatatatcatttgtgtcggcaaacatcatttgagttttaattttttatgagctaactcgatttacttaaggatacgaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
20868318 |
gaaaagaagaaaacaaaggaggaatatatcatttgtgtcggcaaacatcatttgagttttaatttttcatgagctaactcgatttacttaaggatacgga |
20868219 |
T |
|
| Q |
202 |
ttacatgggatttgctaattgaacgtttcat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20868218 |
ttacatgggatttgctaattgaacgtttcat |
20868188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 154 - 232
Target Start/End: Complemental strand, 3408524 - 3408446
Alignment:
| Q |
154 |
tgagttttaattttttatgagctaactcgatttacttaaggatacgaattacatggg-atttgctaattgaacgtttcat |
232 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
3408524 |
tgagttttaatttttcatgagctaactcgatttacttaaggatacgaattacatgggaatttgctaattg-acgtttcat |
3408446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 20868418 - 20868384
Alignment:
| Q |
1 |
catttcctttagagttgagctgaactagagctgta |
35 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
20868418 |
catttcctttagagttgagctggactagagctgta |
20868384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 102 - 155
Target Start/End: Complemental strand, 44738074 - 44738021
Alignment:
| Q |
102 |
gaaaagaagaaaacaaaggaggaatatatcatttgtgtcggcaaacatcatttg |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44738074 |
gaaaagaagaaaacaaaggaggaatatatcatttgtgtcggcaaacatcatttg |
44738021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University