View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1470_low_8 (Length: 306)
Name: NF1470_low_8
Description: NF1470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1470_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 20 - 298
Target Start/End: Original strand, 43168911 - 43169189
Alignment:
| Q |
20 |
attcgagtatatgccggatggttcagaagttggtaaacacggtgaaacagatggatcccaaggatccttttcgagttgatatgactgataagcttttgga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43168911 |
attcgagtatatgccggatggttcagaagttggtaaacacggtgaaacagatggatcccaaggatccttttcgagttgatatgactgataagcttttgga |
43169010 |
T |
|
| Q |
120 |
aaaactgtaagttcactttttgaagttcaaagtttaaacatatttgatttcagtaattaatattggtttcataattatggttactgctatatgtcataat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43169011 |
aaaactgtaagttcactttttgaagttcaaagtttaaacatatttgatttcagtaattaatattgttttcataattatggttactgctatatgtcataat |
43169110 |
T |
|
| Q |
220 |
tattcacgttttccatctttcttttgacataatttattgtttagtgttgttccatgacacccccaaatctatctgtgct |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43169111 |
tattcacgttttccatctttcttttgacataatttattgtttagtgttgttccatgacacccccaaatctatctgtgct |
43169189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University