View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1470_low_9 (Length: 289)
Name: NF1470_low_9
Description: NF1470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1470_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 19 - 158
Target Start/End: Complemental strand, 2272309 - 2272170
Alignment:
| Q |
19 |
caacaagcaatagataccacgtttaatttgggcattaatagtatcggcttggtttgttttcctacaactcactatagcattcttaacatttttatcattc |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2272309 |
caacaagcaagagataccacgtttaatttgggcattaatagtatcggcttggtttgttttcctacaactcactataacattcttaacatttttatcattg |
2272210 |
T |
|
| Q |
119 |
gatcaagggatgaaaaaattctcatggttggtttgaataa |
158 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2272209 |
gatcaagggatgaaaacattctcatggttggtttgaataa |
2272170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 225 - 284
Target Start/End: Complemental strand, 2272105 - 2272046
Alignment:
| Q |
225 |
gttatgtcttcgtaataattgatatctgtatggagattatattctactctctctgctcct |
284 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2272105 |
gttatgccttcgtaataattgatatctgtatggagattatattctactctctctgttcct |
2272046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University