View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14711_high_15 (Length: 307)
Name: NF14711_high_15
Description: NF14711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14711_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 12371844 - 12372130
Alignment:
| Q |
1 |
caagcaaccgaacacgagttggtatatttctactannnnnnnnaacagccaattttataaataaaggtcactactttcctaatttctctgatggttttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12371844 |
caagcaaccgaacacgagttggtatatttctactattttttttaacagccaattttataaataaaggtcactactttcctaatttctttgatggttttga |
12371943 |
T |
 |
| Q |
101 |
ccaaacaatcactcaaaatattttacaataattaactgccagcaatccatcaacgagacaaaaacgaagtgttaaccacacactctcaaacactctcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12371944 |
ccaaacaatcactcaaaatattttacaataattaactgccagcaatccatcaacgagacaaaaacgaagtgttaaccacacactctcaaacactctcttt |
12372043 |
T |
 |
| Q |
201 |
tagatgaaattgattggggttgctcacaccaattgaaaattgtgtcttgctaaataagtctattaagacccacgatttataagtgtta |
288 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12372044 |
tagatgaaattgattggtgtggctcacaccaattgaaaa-tgtgtcttgctaaataagtctattaagacccacgatttataagtgtta |
12372130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University