View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14711_high_24 (Length: 236)
Name: NF14711_high_24
Description: NF14711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14711_high_24 |
 |  |
|
| [»] scaffold0275 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0275 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 7991 - 7792
Alignment:
| Q |
19 |
ggccaatgaagcatatatccggaatttggctgggccgggtgaccaaccggttttgttatatttatttagatactcgctcatcgcgttttcagagttcatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7991 |
ggccaatgaagcatatatccggaatttggctgggccgggtgaccaaccggttttgttatatttatttagatactcgctgatcgcgttttcagagttcatt |
7892 |
T |
 |
| Q |
119 |
ttctatcccttcccttgtttttcacagtcctctcgtcttgcttttgcttgctggtatttatttttattcctttgcaattctacttcattcatagcttttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7891 |
ttctatcccttcccttgtttttcacagtcctctcgtcttgcttttgcttgctggtatttatttttattcttttgcaattctacttcattcatagcttttc |
7792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275; HSP #2
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 206
Target Start/End: Complemental strand, 22456 - 22270
Alignment:
| Q |
19 |
ggccaatgaagcatatatccggaatttggctgggccgggtgaccaaccggttttgttatatttatttagatactcgctcatcgcgttttcagagttcatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22456 |
ggccaatgaagcatatatccggaatttggctgggccgggtgaccaaccggttttgttatatttatttagatactcgctgatcgcgttttcagagttcatt |
22357 |
T |
 |
| Q |
119 |
ttctatcccttcccttgtttttcacagtcctctcgtcttgcttttgcttgctggtatttatttttattcctttgcaattctacttcat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22356 |
ttctatcccttcccttgtttttcacagtcctctcgtcttgc-tttgcttgctggtatttatttttattcttttgcaattctacttcat |
22270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 62
Target Start/End: Original strand, 5003321 - 5003368
Alignment:
| Q |
15 |
cataggccaatgaagcatatatccggaatttggctgggccgggtgacc |
62 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5003321 |
cataggccaataaagcatatatccggaattttgctgggccgggtgacc |
5003368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University