View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14711_high_28 (Length: 216)
Name: NF14711_high_28
Description: NF14711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14711_high_28 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 45367098 - 45366883
Alignment:
| Q |
1 |
ttttagtgagtggccatctaatattgctattcacactttcacaaggaatcacttaatcttaaaatttagttttacagtagttagaatttgcttctcnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45367098 |
ttttagtgagtggccatctaatattgctattcacactttcacaaggaatcacttaatcttaaaatttagttttacagtagttagaatttgcttctctttt |
45366999 |
T |
|
| Q |
101 |
nnnaatactgtcgtgataactgttaacaacatttggtgctggttgtgctgttacgacaatccatctgtgataaagaaattcatttctatgcattgacggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45366998 |
tttaatactgtcgtgataactgttaacaacatttggtgctggttgtgctgttacgacaatccatctgtgataaagaaattcatttctatgcattgacggt |
45366899 |
T |
|
| Q |
201 |
gaaactttcttacaca |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45366898 |
gaaactttcttacaca |
45366883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University