View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14711_low_24 (Length: 238)
Name: NF14711_low_24
Description: NF14711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14711_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 43758734 - 43758654
Alignment:
| Q |
140 |
aagtgataagatggatcatagtataaatcattatcagcattttagcatggatcgaaccttccaaaatttgcctcagctgtc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43758734 |
aagtgataagatggatcatagtataaatcattatcagcattttagcatggatcgaaccttccaaaatttgcctcagctgtc |
43758654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 43758861 - 43758807
Alignment:
| Q |
12 |
cgaagaaaatatcctcttcttacttaattggaattcaagatggtaatttagagag |
66 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43758861 |
cgaagaaaatatcctcttctcacttaattggaattcaagatggtaatttagagag |
43758807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University