View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14711_low_28 (Length: 225)
Name: NF14711_low_28
Description: NF14711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14711_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 39803113 - 39803330
Alignment:
| Q |
1 |
aattcgtaccgattgttctgtgctttaatcaagtgtattatgtaagctggggaagtcacaaagggtgactatagattatttgttaattaatgttaataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39803113 |
aattcgtaccgattgttctgtgctttaatcaagtgtataatgtaagctggggaagtcacaaagggtgactatagattatttgttaattaatgttaataaa |
39803212 |
T |
 |
| Q |
101 |
tttgtttgccaacaaattaagagtggtttggatgttnnnnnnnnggaagataaggggagagaaaaagttgagcttttctttgatgtaatttaagttccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39803213 |
tttgtttgccaacaaattaagagtggtttggatgtt-aaaaaaaggaagataaggggagagaaaaaattgagcttttctttgatgtaatttaagttccaa |
39803311 |
T |
 |
| Q |
201 |
ataattcagtgtcccctat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39803312 |
ataattcagtgtcccctat |
39803330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University