View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14712_high_12 (Length: 328)
Name: NF14712_high_12
Description: NF14712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14712_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 18 - 294
Target Start/End: Complemental strand, 41509224 - 41508940
Alignment:
| Q |
18 |
cacatgtgtcttatgtacggtattaattaaaccgtgttaacttaacatattcaaagtcagtgtatttgtcttagatcttttaggtaatgttttagattag |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41509224 |
cacatgtgtcttatgtacggtattaa----accgtgttaacttaacatattcaaaatcagtgtatttgtcttagatcttttaggtaatgttttagattag |
41509129 |
T |
 |
| Q |
118 |
agtttttgccaactgaaaaaatgggtttgcgagagaatattccaccta----aagaccgcggggtca-------tttttgatggaaatattagttattga |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41509128 |
agtttttgccaactgaaaaagtgggtttgcgaaagaatattccacctaaagaaagaccgcggggtcaattaacttttttgatggaaatattagttattga |
41509029 |
T |
 |
| Q |
207 |
taaaatagtaacattgttaatgaacaaaatatggaattaggtaacatatctaaaacccctccatgttttagacttatac-tggtatatt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
41509028 |
taaaatagtaacattgttaatgaacaaaatatggagttaggtaacatatctaaaactcctccatgttttagacttatacttggtatatt |
41508940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University