View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14712_low_16 (Length: 275)
Name: NF14712_low_16
Description: NF14712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14712_low_16 |
 |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 4 - 251
Target Start/End: Original strand, 16570 - 16817
Alignment:
| Q |
4 |
ggttgtgatgcaaataattaaaaattgttttagaggtttgtgtgcgcgtgtttagaatatatgtatatgtaattgaatcctcggttgtgatttatcatgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16570 |
ggttgtgatgcaaataattaaaaattgttttagaggtttgtgtgcgcgtgtttagaatatatatatatgtaattgaatcctcggttgtgatttatcatgt |
16669 |
T |
 |
| Q |
104 |
tagcatttttcttattcgttgcataggagtatactagtttctagagaaaatatccttaagattgtgattgtctaaatgtatgtgtttaggtaacatttca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16670 |
tagcatttttcttattcgttgcataggagtatactagtttgtagagaaaatatccttgagattgtgattgtctaaatgtatgtgtttaggtaacatttca |
16769 |
T |
 |
| Q |
204 |
aacattgatgtattagcattcctatatcagaagggaaaatcttcattg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16770 |
aacattgatgtattagcattcctatatcagaagggaaaatcttcattg |
16817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University