View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14712_low_19 (Length: 259)
Name: NF14712_low_19
Description: NF14712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14712_low_19 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 7 - 259
Target Start/End: Complemental strand, 2819307 - 2819054
Alignment:
| Q |
7 |
atgtgggtgtcaaacaaaggatgtgcctttaatttgagtgtcgtgctacatagttacacacactagctaggatttgaattagacgtagtaactgcatcat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
2819307 |
atgtgggtgtcaaacaaaggatgtgcctttaatttgagtatcgtgctacatagttacgcacactagctaggatttgaattagacatggtaactgcatcat |
2819208 |
T |
 |
| Q |
107 |
acagtattgtatcttgatcgtccgatctaaatcaaaatccgagatcaattaaatgtgtgaaactgatgat-gtaatttaaactgtttgatcttaaatcaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
2819207 |
acagtattgtatcttgatcgtccgatctaaatcaaaatccgagatcaattaaatgtgtgaaactgacgatggtaatttaaactgtttgatcttaaatcaa |
2819108 |
T |
 |
| Q |
206 |
cgattaagatcacttaaatgtaaaattgtgacccacattaaccatagtatcaac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2819107 |
cgattaagatcacttaaatgtaaaattgtgacccacattaaccatagtgtcaac |
2819054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University