View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14712_low_22 (Length: 252)
Name: NF14712_low_22
Description: NF14712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14712_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 3604822 - 3605049
Alignment:
| Q |
20 |
atacgctacctccagcaacaaccaaagggtctttttgccctgttctctgtctttgatcaacttccannnnnnnngt--ggattttctacggtatatatac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
3604822 |
atacgctacctccagcaacaaccaaagggtctttttgccctgttctctgtctttgatcaacttccattttttttttttggattttctacgctatatatac |
3604921 |
T |
 |
| Q |
118 |
gatgcaataaaatatgtataatacatagttacatttggttttttaatttgaaattgcttgcaaaatgtcaaataaaagaatatatttttacacaaatttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3604922 |
gatgcaataaaatatgtataatacatagttacatttggttttttaatttgaaattgcttgcaaaatgtcaaataaaagaatatatttttacacaaatttg |
3605021 |
T |
 |
| Q |
218 |
aacaaagttttaggtcgtttttcatatc |
245 |
Q |
| |
|
||||||||||||||| |||||||||||| |
|
|
| T |
3605022 |
aacaaagttttaggttgtttttcatatc |
3605049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University