View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14712_low_29 (Length: 219)
Name: NF14712_low_29
Description: NF14712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14712_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 52325157 - 52325044
Alignment:
| Q |
1 |
ttctagtgttctcacctttgtacttcgaataaatttctcaaagggacctaaaaacacccaaaaataagtgagtacatacatttacacacatgctactaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52325157 |
ttctagtgttctcacctttgtacttcgaataaatttctcaaagggacctaaaaacacccataaataagtgagtatatacatttacacacatgctactaac |
52325058 |
T |
|
| Q |
101 |
tataattcattgct |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52325057 |
tataattcattgct |
52325044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 52329587 - 52329515
Alignment:
| Q |
1 |
ttctagtgttctcacctttgtacttcgaataaatttctcaaagggacctaaaaacacccaaaaataagtgagt |
73 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||| |||||| ||||| |
|
|
| T |
52329587 |
ttctagtgttctcacctttgtacatcgaataaacttctcaaagggacctaaacacacccataaataaatgagt |
52329515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 167 - 214
Target Start/End: Complemental strand, 52324903 - 52324856
Alignment:
| Q |
167 |
atgattaggggcatatgatcattatggagtagtatgttgctacctttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52324903 |
atgattaggggcatatgatcattatggagtagtatgttgctacctttg |
52324856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 78
Target Start/End: Complemental strand, 9179273 - 9179216
Alignment:
| Q |
21 |
tacttcgaataaatttctcaaagggacctaaaaacacccaaaaataagtgagtacata |
78 |
Q |
| |
|
||||||||||||||||||||||| |||||||| || |||| | ||| ||||||||||| |
|
|
| T |
9179273 |
tacttcgaataaatttctcaaagagacctaaacactcccatagatacgtgagtacata |
9179216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University