View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_high_28 (Length: 381)
Name: NF14713_high_28
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_high_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 30418816 - 30418450
Alignment:
| Q |
1 |
tttacttttgttgcacggaaatggtgaatttgtggtggggaggaagatggttgaagataaggggtcatggaatttgaatatttaggatagggagttttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30418816 |
tttacttttgttgcacggaaatggtgaatttgtggtggggaggaagatgattaaagataaggggtcatggaatttgaatatgtaggatagggagttttta |
30418717 |
T |
 |
| Q |
101 |
aaaggtggcagaacaacttgaaattttcagattttgatgaagaaacggtggctgggaatagtgtgatggtggcgagaatcaatatcatcacatctttggt |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30418716 |
aaaggtggcagaacaacttgacattttcagattttgatgaagagacggtggctggaaatagtgtgatggtggcgagaatcaatatcatcacatctttggt |
30418617 |
T |
 |
| Q |
201 |
aaggaggaccactcttcatcggcatctagtggtaaagcgaatcgattttgactcgtgggtggttgaaaagggcaacggaa----ggagtgccaggatcta |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
30418616 |
aaggaggaccactcttcatcggcatctagtggtaaagcggatcaattttgactcgtgggtggttgaaaagggcaacggaaggagggagtgctaggatcta |
30418517 |
T |
 |
| Q |
297 |
gaaaaacggtctgattttgaattttctggtacctcagtcggaaagttccagataaggtggcgtgtgt |
363 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30418516 |
gaaaaacggtttgattttgaaatttctggtacctcagtcggaaagttccaaataaggtggcgtgtgt |
30418450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University