View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_high_42 (Length: 308)
Name: NF14713_high_42
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 292
Target Start/End: Original strand, 38193737 - 38194028
Alignment:
| Q |
1 |
attggtatcttccaactgataatatctattttggggcttaatcaagtttggactatctacaacctaatgatgaactgatttcaaatcttgtagcattgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38193737 |
attggtatcttccaactgataatatctattttggggcttaatcaagtttggactatctacaacctaatgatgaactgatttcaaatcttgtagctttgtt |
38193836 |
T |
 |
| Q |
101 |
tgcgcacaactaaagatcaaccattgagcatcaattacattattccagattataatattacgttgctttcaaatactccataagacacaagcaaataaat |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38193837 |
tgcgcacaactaaagatcaaacattgagcatcaattacattattccagattataatattacattgctttcaaatactccataagacacaagcaaataaat |
38193936 |
T |
 |
| Q |
201 |
tcgaatcttcaattgttaattgctgcggaatttggaaaacaatacctgaaatggcttgctctccgttcataacatccctcacaccatgagaa |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38193937 |
tcgaatcttcaattgttaattgctgcggaatttggaaaacaatacctgaaatggcttgctctccgttcataacatccctcacaccatgagaa |
38194028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University