View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_high_44 (Length: 303)
Name: NF14713_high_44
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 283
Target Start/End: Original strand, 29632508 - 29632767
Alignment:
| Q |
20 |
ttaaggtgcctgagcatttgaagattgatgaagtatgattggaagactgtttaattatgcttgcattagaacttcatttttatttgattttattgtgtgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29632508 |
ttaaggtgcctgagcatttgaagattgatgaagtatgattggaagactgtttaattatgcttgcattagaacttcatttttatttgatcttattgtgtgc |
29632607 |
T |
 |
| Q |
120 |
taaagatgcttttttattgatttatgtggtcttaagtgttttgcttaatgcatgtttggattcactgtttgtagatagcctgaccgctatgnnnnnnnat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
29632608 |
taaagatgcttttttattgatttatgtggtcttaagtgttttgcttaatgcatgtttggattcactgtttgtagatagcctgaccgccatgtttttttat |
29632707 |
T |
 |
| Q |
220 |
tttaatgtttatgtaattatatatatcattcgaggacagttgcatatcctctgttttgtttcat |
283 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
29632708 |
tttaatgtttatgtaat----tatatcattcgaggtcagttgcatatccactgttttgtttcat |
29632767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 29631303 - 29631360
Alignment:
| Q |
30 |
tgagcatttgaagattgatgaagtatgattggaagactgtttaattatgcttgcatta |
87 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||||||||||| |||||||| |
|
|
| T |
29631303 |
tgagcatttgaagattgatcaagtatgattccaacactgtttaattatgtttgcatta |
29631360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 113
Target Start/End: Original strand, 16488410 - 16488450
Alignment:
| Q |
73 |
attatgcttgcattagaacttcatttttatttgattttatt |
113 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||||||||| |
|
|
| T |
16488410 |
attatgcttgcataaaaactttatttttatttgattttatt |
16488450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University