View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_high_50 (Length: 276)
Name: NF14713_high_50
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_high_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 12 - 259
Target Start/End: Original strand, 28076659 - 28076900
Alignment:
| Q |
12 |
ataattttttcaagtaaaaatatatttatatttgacctgtgagttcactgtttgtttccatgttgacttcgatttcttctcgttacctgccattacttat |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||| ||| |||||||||||| ||||||||| |||||| |||| |||||||| |
|
|
| T |
28076659 |
ataattttttcaagtaaaaatat--ttatatttaacctgtgagttcactattt----ccatgttgacttggatttcttcccgttacttgccgttacttat |
28076752 |
T |
|
| Q |
112 |
catctgacacatgtcatagacattttgctcttctatttctttgattttgcattctgatttatagtttgatagctaattgtgtgtttccctgatatgtttg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
28076753 |
catctgacacatgtcatagacattttgcttttctatttctttgattttgcactctgatttttagattgataactaattgtgtgtttccctgatatgtttg |
28076852 |
T |
|
| Q |
212 |
gaaatttacaataaataggtaaaagggagagatcgcttggttttgaaa |
259 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
28076853 |
gaaatttacaataaataggtacaagggagagatcggttggttttgaaa |
28076900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University