View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_high_52 (Length: 269)
Name: NF14713_high_52
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_high_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 1744406 - 1744643
Alignment:
| Q |
19 |
ctatcaccaagggcactatttatagcctctgatgaagctttaaaatattgatcaataatatttttaaattaatgttgctccacattctcttattcttatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1744406 |
ctatcaccaagggcactatttatagcctctgatgaagctttaaaatattgatcaataatatttttaaattaatgttgctccacattgtcttattcttatt |
1744505 |
T |
|
| Q |
119 |
tcctagtgtcaagatggatgcctacaaaaaatgcatgattttaatattttaaccaaaatcaggggcggagctaggttttatacatcgggggaccaagtct |
218 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1744506 |
tcctagtgtcaagatggatgcctactaacaatgcatgattttaatattttaaccaaaatcaggggcggagctaggttttatacatcgggggaccaagtct |
1744605 |
T |
|
| Q |
219 |
taaaaagtataatttta--gtgtcttatgaaccctttg |
254 |
Q |
| |
|
|| |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
1744606 |
tagaaagtataattttagtgtgtcctatgaaccctttg |
1744643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 24 - 138
Target Start/End: Original strand, 1722310 - 1722425
Alignment:
| Q |
24 |
accaagggcactatttatagcctctgatgaagctttaaaatattgatcaataata-tttttaaattaatgttgctccacattctcttattcttatttcct |
122 |
Q |
| |
|
|||||||||||||| |||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
1722310 |
accaagggcactatatatagcctttgatgatgctttaaaatattgatcaataataatttttaaattaatgttgctccacattctcttcttcctatttcct |
1722409 |
T |
|
| Q |
123 |
agtgtcaagatggatg |
138 |
Q |
| |
|
| | |||||||||||| |
|
|
| T |
1722410 |
aatctcaagatggatg |
1722425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University