View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14713_high_61 (Length: 242)

Name: NF14713_high_61
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14713_high_61
NF14713_high_61
[»] chr1 (2 HSPs)
chr1 (187-223)||(25814482-25814518)
chr1 (11-44)||(25814429-25814462)


Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 25814482 - 25814518
Alignment:
187 aagttttgtctacaaatacatgtacccaacaaaattt 223  Q
    |||||||||||||||||||||||||||||||||||||    
25814482 aagttttgtctacaaatacatgtacccaacaaaattt 25814518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 11 - 44
Target Start/End: Original strand, 25814429 - 25814462
Alignment:
11 aagaatatcaccattcaaaaaatatttgctttta 44  Q
    ||||| ||||||||||||||||||||||||||||    
25814429 aagaaaatcaccattcaaaaaatatttgctttta 25814462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University