View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_high_64 (Length: 237)
Name: NF14713_high_64
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_high_64 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 37708582 - 37708793
Alignment:
| Q |
17 |
tatagttcttagttaa-gacaaaatttccgatttgcagttctttttatggaggctatatatctttgatacaaacattgctaaatttttggaaacatttcc |
115 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37708582 |
tatagtttttagttaaagacaaaatttccgatttgcagttctttttatggaggctatatatctttaatacaaacattgctaaatttttggaaacatttcc |
37708681 |
T |
 |
| Q |
116 |
acaagaattgcaagaatataactatgtattattgttaagaatagattttggaacaaaccttgggtataaaagcatataatgtcgctataatctgc-aaca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
37708682 |
acaagaattgcaagaatataactatgtatta-tgttaa----------tagaacaaaccttgggtataaaagcatataatgtcgctataatctgcaaaaa |
37708770 |
T |
 |
| Q |
215 |
aaattactaagtgacttggatac |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37708771 |
aaattactaagtgacttggatac |
37708793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University