View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_high_66 (Length: 227)
Name: NF14713_high_66
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_high_66 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 30 - 223
Target Start/End: Original strand, 23097152 - 23097345
Alignment:
| Q |
30 |
tattgttagagaggtataaatatatttttagtgaataaggttagccaatagcaccctttaataaaagttactaagttagccaataaattttgaatttgaa |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23097152 |
tattgttagagaggtataaatataattttggcgaataaggttagccaataacaccctttaataaaagttactaagttagccaataatttttgaatttgag |
23097251 |
T |
 |
| Q |
130 |
gatagtaactatggttgtgaatatcataatcgatatggcaaacgaatcattaaatgatggtgttaataaatcatcacttgcattagaaagagaa |
223 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23097252 |
aatagtggctattgttgtgaatatcataaaggatatggcaaacgaatcattaaatgatggtgttaataaatcatcacttgcattggaaagagaa |
23097345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University