View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_high_67 (Length: 222)
Name: NF14713_high_67
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_high_67 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 17 - 107
Target Start/End: Original strand, 29020513 - 29020603
Alignment:
| Q |
17 |
aaaatagggtaaaattgtgtgcaatataccaaaatgatggactcctccctaaatcctgcatatgtggttgctttagtgcatctgtttgccc |
107 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
29020513 |
aaaatacggtaaaattgtgtgcaatacaccaaaatgatggactcctccctaaattctgcgtatgtggtagctttagtgcatctgtctgccc |
29020603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 159 - 200
Target Start/End: Original strand, 29020627 - 29020668
Alignment:
| Q |
159 |
atggttgaaattttaatggtaaaggtggcagagtgcaagtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29020627 |
atggttgaaattttaatggtaaaggtggcagagtgcaagtga |
29020668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University