View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_high_69 (Length: 219)
Name: NF14713_high_69
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_high_69 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 25814215 - 25814433
Alignment:
| Q |
1 |
agacaaaacgcaattttgacatgtgtgattaagcataaggtgtttatccactagaggagccaagcaagtgctaccatttaaccatttctagttccaaaat |
100 |
Q |
| |
|
|||||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814215 |
agacaaaaagcaaatttgacatgtatgattaagcataaggtgtttatccactagaggagccaggcaagtgctaccatttaaccatttctagttccaaaat |
25814314 |
T |
 |
| Q |
101 |
gattgtcctcacctttaccaatactctacctgcatccttctcacaataaaaacctatgtagaccttatactatgtcaaacatagcttgaattgtgatcaa |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25814315 |
gactgtcctcacctttaccaatactctacctgcatccttctcacaataaaaacctatgtagaccttatagtatgtcaaacatagcttgaattgtgatcaa |
25814414 |
T |
 |
| Q |
201 |
ttaaactgagctccaagaa |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25814415 |
ttaaactgagctccaagaa |
25814433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University