View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_low_47 (Length: 311)
Name: NF14713_low_47
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_low_47 |
 |  |
|
| [»] chr1 (19 HSPs) |
 |  |
|
| [»] chr8 (8 HSPs) |
 |  |
|
| [»] chr7 (28 HSPs) |
 |  |
|
| [»] chr6 (9 HSPs) |
 |  |
|
| [»] chr3 (16 HSPs) |
 |  |
|
| [»] scaffold1674 (1 HSPs) |
 |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |
|
| [»] chr5 (14 HSPs) |
 |  |
|
| [»] chr2 (7 HSPs) |
 |  |
|
| [»] scaffold0468 (1 HSPs) |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 13)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 40005068 - 40004822
Alignment:
| Q |
18 |
gtcacataggaaaagaaatgtaaatattgtaaacatggattttttaaaacatcaaggtttctaattctagcaacttatcctaattaaggatccgtatttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
40005068 |
gtcacataggaaaagaaatgtaaatattgtaaacatggattttttaaaacatcaaggtttcta------gcaacttatcctaa----ggatccgtatttc |
40004979 |
T |
 |
| Q |
118 |
tagtttggatcnnnnnnnnnnnnnntaaattttgaatgtaaccgtttgaactattgtcttctggcttctttgttggataaattgatagtagattgtggat |
217 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40004978 |
tagtttggatcaaaaaataaaaaaataaattttgaatgtaacccgttgaactattgtcttctggcttctttgttggataaattgatagtagattgtggat |
40004879 |
T |
 |
| Q |
218 |
tgttacatgtgtggga------aaatcaaagggggaactgcctgagagattgagagt |
268 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40004878 |
cgttacatgtgtgggaactgggaaatcaaagggggaactgcctgagagattgagagt |
40004822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 24347958 - 24348001
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24347958 |
ttgttgtagtatgactcaaaatttgatggatggagaatattgtt |
24348001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 56030188 - 56030231
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
56030188 |
ttgttgtagtatgactcaaaatttgatggatggagaatattgtt |
56030231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 5100743 - 5100785
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5100743 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
5100785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 14788021 - 14787979
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14788021 |
tgttgtagtatgactcaaaatttgatggatggagaataatgtt |
14787979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 22135219 - 22135177
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22135219 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
22135177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 271 - 306
Target Start/End: Original strand, 19322410 - 19322445
Alignment:
| Q |
271 |
ttgtagtatgactcaaaatttgatggatggagaata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19322410 |
ttgtagtatgactcaaaatttgatggatggagaata |
19322445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 38890702 - 38890659
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
38890702 |
ttgttgtagcatgactcaaaatttgatggatggagaatattgtt |
38890659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 44600429 - 44600386
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
44600429 |
ttgttgtagtatgactcaaaaattgatggatggagaatattgtt |
44600386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 47211309 - 47211266
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
47211309 |
ttgttgtagtatgacttaaaatttgatggatggagaatattgtt |
47211266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 14789571 - 14789529
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
14789571 |
tgttgtagtatgactcaaaatttgatggatgaagaataatgtt |
14789529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 22132987 - 22132945
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
22132987 |
tgttgtagtatgattcaaaatttgatggatggagaatattgtt |
22132945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 17662827 - 17662784
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
17662827 |
ttgttgtagtatgactacaaatttgatggatggagaatattgtt |
17662784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 19)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 266 - 311
Target Start/End: Original strand, 24325344 - 24325389
Alignment:
| Q |
266 |
agttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24325344 |
agttgttgtagtatgactcaaaatttgatggatggagaatattgtt |
24325389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 267 - 311
Target Start/End: Complemental strand, 17325229 - 17325185
Alignment:
| Q |
267 |
gttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17325229 |
gttgttgtagtatgactcaaaatttgatggatggagaatattgtt |
17325185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 28998845 - 28998802
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28998845 |
ttgttgtagtatgactcaaaatttgatggatggagaatattgtt |
28998802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 29004561 - 29004518
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29004561 |
ttgttgtagtatgactcaaaatttgatggatggagaatattgtt |
29004518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 4131882 - 4131840
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4131882 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
4131840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 9460013 - 9459971
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9460013 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
9459971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 9463840 - 9463798
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9463840 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
9463798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 39931762 - 39931804
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39931762 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
39931804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 46432636 - 46432594
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46432636 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
46432594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 47905956 - 47905998
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47905956 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
47905998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 48664852 - 48664894
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48664852 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
48664894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 31736115 - 31736073
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
31736115 |
tgttgtagtatgactcaaaatttgatggaaggagaatattgtt |
31736073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 269 - 306
Target Start/End: Original strand, 6997214 - 6997251
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaata |
306 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6997214 |
tgttatagtatgactcaaaatttgatggatggagaata |
6997251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 269 - 306
Target Start/End: Complemental strand, 6997427 - 6997390
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaata |
306 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6997427 |
tgttgtagtatgactcaaaatatgatggatggagaata |
6997390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 15295440 - 15295397
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||| |||| |
|
|
| T |
15295440 |
ttgttgtagtatgactcaaaatttgatggaagaagaatattgtt |
15295397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 300
Target Start/End: Complemental strand, 21964397 - 21964366
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21964397 |
tgttgtagtatgactcaaaatttgatggatgg |
21964366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 27337532 - 27337490
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||| |||| |
|
|
| T |
27337532 |
tgttgtagtatgactccaaatttgatggatggggaatattgtt |
27337490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 27339730 - 27339688
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||| |||| |
|
|
| T |
27339730 |
tgttgtagtatgactccaaatttgacggatggagaatattgtt |
27339688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 45694024 - 45693982
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||| |||| |
|
|
| T |
45694024 |
tgttgtactatgattcaaaatttgatggatggagaatattgtt |
45693982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 3873749 - 3873792
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3873749 |
ttgttgtagtatgactcaaaatttgatggatggagaatattgtt |
3873792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 3265752 - 3265710
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3265752 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
3265710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 32339094 - 32339136
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32339094 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
32339136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 41384493 - 41384535
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41384493 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
41384535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 43529871 - 43529913
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43529871 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
43529913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 306
Target Start/End: Complemental strand, 28283813 - 28283776
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28283813 |
tgttgtagtatgactcaaaatttgatggatggagaata |
28283776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 270 - 311
Target Start/End: Original strand, 41382420 - 41382461
Alignment:
| Q |
270 |
gttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41382420 |
gttgtagtatgactcaaaatttgatggatggagaatattgtt |
41382461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 15808961 - 15809004
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15808961 |
ttgttttagtatgactcaaaatttgatggatggagaatattgtt |
15809004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 28)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 37412717 - 37412674
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37412717 |
ttgttgtagtatgactcaaaatttgatggatggagaatattgtt |
37412674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 443326 - 443368
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
443326 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
443368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 3035415 - 3035457
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3035415 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
3035457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 7092768 - 7092726
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7092768 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
7092726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 7095015 - 7094973
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7095015 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
7094973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 7472574 - 7472532
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7472574 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
7472532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 11756925 - 11756967
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11756925 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
11756967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 18345237 - 18345279
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18345237 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
18345279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 20299155 - 20299197
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20299155 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
20299197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 28487249 - 28487291
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28487249 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
28487291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 266 - 311
Target Start/End: Original strand, 3676994 - 3677039
Alignment:
| Q |
266 |
agttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
3676994 |
agttgttgtagtatgactcaaaatttgatagatggagaatattgtt |
3677039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 306
Target Start/End: Complemental strand, 7470621 - 7470584
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7470621 |
tgttgtagtatgactcaaaatttgatggatggagaata |
7470584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 7352247 - 7352204
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7352247 |
ttgttgtagtatgactcaaaaattgatggatggagaatattgtt |
7352204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 20625733 - 20625776
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20625733 |
ttgttctagtatgactcaaaatttgatggatggagaatattgtt |
20625776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 20629624 - 20629667
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20629624 |
ttgttctagtatgactcaaaatttgatggatggagaatattgtt |
20629667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 20642043 - 20642086
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20642043 |
ttgttctagtatgactcaaaatttgatggatggagaatattgtt |
20642086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 21989852 - 21989895
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
21989852 |
ttgttgtagtatgacccaaaatttgatggatggagaatattgtt |
21989895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 7349867 - 7349825
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7349867 |
tgttgtagtatgactcaaaaattgatggatggagaatattgtt |
7349825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 31156500 - 31156458
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31156500 |
tgttgtagtatgactcaaaaattgatggatggagaatattgtt |
31156458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 38395986 - 38396028
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
38395986 |
tgttgtagtatgactccaaatttgatggatggagaatattgtt |
38396028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 47865328 - 47865370
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
47865328 |
tgttgtagtatgactccaaatttgatggatggagaatattgtt |
47865370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 1606171 - 1606213
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| |||| |
|
|
| T |
1606171 |
tgttgtagtatgactcaaaatttgatggaagaagaatattgtt |
1606213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 1849665 - 1849707
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| |||| |
|
|
| T |
1849665 |
tgttgtagtatgactcaaaatttgatggaagaagaatattgtt |
1849707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 21470883 - 21470841
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||| |||| |
|
|
| T |
21470883 |
tgttgtagtttgactccaaatttgatggatggagaatattgtt |
21470841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 28485261 - 28485303
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
28485261 |
tgttgtagtatgattcaaaatttgatggatgaagaatattgtt |
28485303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 38393683 - 38393725
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||| |||| |
|
|
| T |
38393683 |
tgttgtagtatgattctaaatttgatggatggagaatattgtt |
38393725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 311
Target Start/End: Original strand, 20297108 - 20297140
Alignment:
| Q |
279 |
tgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
20297108 |
tgactcaaaatttgatggatggagaatattgtt |
20297140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 272 - 304
Target Start/End: Complemental strand, 40281989 - 40281957
Alignment:
| Q |
272 |
tgtagtatgactcaaaatttgatggatggagaa |
304 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
40281989 |
tgtagtatgactcaaaatttgatggatgaagaa |
40281957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 30035197 - 30035154
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30035197 |
ttgttgtagtatgactcaaaatttgatggatggagaatattgtt |
30035154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 5275928 - 5275886
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5275928 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
5275886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 26933159 - 26933116
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26933159 |
ttgttgtagtatgactcaaaaattgatggatggagaatattgtt |
26933116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 12196104 - 12196062
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12196104 |
tgttgtagtatgactcaaaaattgatggatggagaatattgtt |
12196062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 22858536 - 22858494
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
22858536 |
tgttgtagtatgactcaaaatttgatggatgaagaatattgtt |
22858494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 30966923 - 30966965
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
30966923 |
tgttgtagtatgactccaaatttgatggatggagaatattgtt |
30966965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 19705166 - 19705123
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||| |||| |
|
|
| T |
19705166 |
ttgttgtagtatgactcaaaatttgatggaagaagaatattgtt |
19705123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 2629479 - 2629437
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| |||| |
|
|
| T |
2629479 |
tgttgtagtatgactcaaaatttgatggaagaagaatattgtt |
2629437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 271 - 311
Target Start/End: Original strand, 20526548 - 20526588
Alignment:
| Q |
271 |
ttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||| |||| |
|
|
| T |
20526548 |
ttgtagtatgactcaaaatttgatgggtgaagaatattgtt |
20526588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 16)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 1313081 - 1313124
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1313081 |
ttgttgtagtatgactcaaaatttgatggatggagaatattgtt |
1313124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 746422 - 746464
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
746422 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
746464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 10622127 - 10622085
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10622127 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
10622085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 25533107 - 25533149
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25533107 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
25533149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 41848804 - 41848846
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41848804 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
41848846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 42991953 - 42991995
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42991953 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
42991995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 271 - 311
Target Start/End: Original strand, 42989954 - 42989994
Alignment:
| Q |
271 |
ttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42989954 |
ttgtagtatgactcaaaatttgatggatggagaatattgtt |
42989994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 455572 - 455615
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
455572 |
ttgttgtagtatgactcaaaatttgatggatggggaatattgtt |
455615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 53918251 - 53918208
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53918251 |
ttgttatagtatgactcaaaatttgatggatggagaatattgtt |
53918208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 457950 - 457992
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
457950 |
tgttgtagtatgactcaaaatttgatggatggggaatattgtt |
457992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 268 - 306
Target Start/End: Original strand, 27000082 - 27000120
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaata |
306 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27000082 |
ttgttgtagtatgactgaaaatttgatggatggagaata |
27000120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 51943042 - 51943084
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
51943042 |
tgttgtagtatgactcaaaatttgatggatgaagaatattgtt |
51943084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 53916082 - 53916040
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
53916082 |
tgttgtagtatgactcaaaatttgagggatggagaatattgtt |
53916040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 4104484 - 4104441
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||| |||| |
|
|
| T |
4104484 |
ttgttgtagtatgactcaaaatttgatggaagaagaatattgtt |
4104441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 6561613 - 6561655
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
6561613 |
tgttgtagtatgactcgaaatttgatggatgaagaatattgtt |
6561655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 27636212 - 27636170
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||| |||| |
|
|
| T |
27636212 |
tgttgtagtatgatttaaaatttgatggatggagaatattgtt |
27636170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1674 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold1674
Description:
Target: scaffold1674; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 95 - 53
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
95 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
53 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 51709 - 51751
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51709 |
tgttgtagtatgactcaaaatttgatggatggagaataatgtt |
51751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 50159 - 50201
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
50159 |
tgttgtagtatgactcaaaatttgatggatgaagaataatgtt |
50201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 14)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 15551925 - 15551967
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15551925 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
15551967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 18466411 - 18466453
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18466411 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
18466453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 25803707 - 25803749
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25803707 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
25803749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 26097421 - 26097463
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26097421 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
26097463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 27912219 - 27912261
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27912219 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
27912261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 306
Target Start/End: Original strand, 18468698 - 18468735
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468698 |
tgttgtagtatgactcaaaatttgatggatggagaata |
18468735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 306
Target Start/End: Complemental strand, 26098841 - 26098804
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26098841 |
tgttgtagtatgactcaaaatttgatggatggagaata |
26098804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 306
Target Start/End: Original strand, 27910135 - 27910172
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27910135 |
tgttgtagtatgactcaaaatttgatggatggagaata |
27910172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 15143219 - 15143262
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15143219 |
ttgttatagtatgactcaaaatttgatggatggagaatattgtt |
15143262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 272 - 311
Target Start/End: Complemental strand, 18509904 - 18509865
Alignment:
| Q |
272 |
tgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18509904 |
tgtagtatgactcaaaatttgatggatggagaatattgtt |
18509865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 18596325 - 18596368
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
18596325 |
ttgttgtactatgactcaaaatttgatggatggagaatattgtt |
18596368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 21288528 - 21288571
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
21288528 |
ttgttgtagtataactcaaaatttgatggatggagaatattgtt |
21288571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 3373630 - 3373588
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
3373630 |
tgttgtagtatgactcagaatttgatggatggagaatattgtt |
3373588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 271 - 311
Target Start/End: Complemental strand, 18511800 - 18511760
Alignment:
| Q |
271 |
ttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
18511800 |
ttgtagtatgactcaaaatttgatggatgaagaatattgtt |
18511760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 23452829 - 23452787
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23452829 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
23452787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 42924094 - 42924052
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42924094 |
tgttgtagtatgactcaaaatttgatggatggagaatattgtt |
42924052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 35218566 - 35218523
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
35218566 |
ttgttgtagtatgactcaaaatttgatggatgaagaatattgtt |
35218523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 268 - 306
Target Start/End: Complemental strand, 27136506 - 27136468
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27136506 |
ttgttgtagtatgactcaaaatttgatggatgaagaata |
27136468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 35216184 - 35216142
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
35216184 |
tgttgtagtatgactcaaaatttgatggatgaagaatattgtt |
35216142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 311
Target Start/End: Original strand, 42452448 - 42452491
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||| |||| |
|
|
| T |
42452448 |
ttgttgtagtatgacttaaaatttgatggatgaagaatattgtt |
42452491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 311
Target Start/End: Complemental strand, 27583907 - 27583865
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
27583907 |
tgttgtagtatgactcaaattttgatggatgaagaatattgtt |
27583865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0468 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0468
Description:
Target: scaffold0468; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 270 - 311
Target Start/End: Complemental strand, 2184 - 2143
Alignment:
| Q |
270 |
gttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2184 |
gttgtagtatgactcaaaatttgatggatggagaatattgtt |
2143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 311
Target Start/End: Complemental strand, 12062 - 12019
Alignment:
| Q |
268 |
ttgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
12062 |
ttgttgtagtatgattcaaaatttgatggatggagaatattgtt |
12019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 311
Target Start/End: Original strand, 78883 - 78925
Alignment:
| Q |
269 |
tgttgtagtatgactcaaaatttgatggatggagaatagtgtt |
311 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
78883 |
tgttgtagtatgacttaaaatttgatggatggagaatattgtt |
78925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University