View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_low_53 (Length: 296)
Name: NF14713_low_53
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_low_53 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 13 - 296
Target Start/End: Original strand, 2023933 - 2024216
Alignment:
| Q |
13 |
ttgcaatatattttatctcacataatgcnnnnnnntctaaaaccttgcaaacttagagagcatttgatatgtcttcactattgaaactttgcagaagcac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2023933 |
ttgcaatatattttatctcacataatgcaaaaaaatctaaaaccttgcaaacttagaaagcatttgatatgtcttcactattgaaactttgcagaagcac |
2024032 |
T |
|
| Q |
113 |
ccacaaaagatcaaaacaacacaggagcaagatattcatgttgaaactttcaagaaaaagtgcaggacaaacctgtaaaattatgcataacagcaaacaa |
212 |
Q |
| |
|
| || ||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||| ||||||||| |||||||||| | |||| ||||| |
|
|
| T |
2024033 |
caactaaagatcaaaacaacacaggagcaacatattcatgctgaaactttcaagaaaaattgcagcacaaacctgccaaattatgcacagcagcgaacaa |
2024132 |
T |
|
| Q |
213 |
aaaacaacccagtagcatggtataaaagagtctaaagcaaagtaatcctgaaaggtatgaattcaaaataatacaatgtatatg |
296 |
Q |
| |
|
|||||||| | ||| |||||||||||| ||||||| || |||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
2024133 |
aaaacaacatatgagcgatgtataaaagagtgtaaagcataggaatcctcaaaggtatgaattcaaaataaaacaatgtatatg |
2024216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University