View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_low_56 (Length: 280)
Name: NF14713_low_56
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 42444404 - 42444139
Alignment:
| Q |
1 |
aactcaacacgaaagtgagagcaatgaaaaggaaataatccatgttcaagagaaactttactttctgcttgatggaagaatgaaagaggtgtgctctaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42444404 |
aactcaacacgaaagtgagagcaatgaaaaggaaataatccatgttcaagagaaactttactttctgcttgatggaagaatgaaagaagtgtgctctaaa |
42444305 |
T |
 |
| Q |
101 |
ta----cattcacaatgattatatatttatatgtaactttgtaagtaacactttttgctggctggcatggttatattatatatgtcatgattcatgtagt |
196 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
42444304 |
taaatacattcacaatgattatatatttatatgtaactttgtaagtaacactttttgctggctagcatggttatattatatatgtcatgattcatgtggt |
42444205 |
T |
 |
| Q |
197 |
gtatatttattcttaagtcggcaacaatgattagtatttgtttttaaaaggttgttgttgtcttgt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444204 |
gtatatttattcttaagtcggcaacaatgactagtatttgtttttaaaaggttgttgttgtcttgt |
42444139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University