View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_low_63 (Length: 252)
Name: NF14713_low_63
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_low_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 27 - 248
Target Start/End: Complemental strand, 23097581 - 23097360
Alignment:
| Q |
27 |
acaacattcccatgtcattggtagcgttggcatttccaatggttctaagttctaacaactcatgattatctctttaattgtctttctcacacattctttg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23097581 |
acaacattcccatgtcattggtagcgttggcatttccaatggttctaagttctaacaactcatgattatctctttaattgtctttctcacacattctttg |
23097482 |
T |
 |
| Q |
127 |
gttggaagttcatacttatttcgtttcatacactccannnnnnnnnnnnnnnnngtattgtaaatcaaggaaaactctgtatatttatgaacaccgatgg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23097481 |
gttggaagttcatacttatttcgtttcatacactccattttttgttttgtttttgtattgtaaatcaaggaaaactctgtatatttatgaacaccgatgg |
23097382 |
T |
 |
| Q |
227 |
tggataacattctacaattgta |
248 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
23097381 |
tggataacattcttcaattgta |
23097360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University