View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_low_65 (Length: 247)
Name: NF14713_low_65
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 14 - 224
Target Start/End: Complemental strand, 3298645 - 3298428
Alignment:
| Q |
14 |
attatactaaaaataacaaataacatgttttattctatcaaccaaattatcnnnnnnnnnnnnt-------ctatcacatatttactaaccgttccaaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
3298645 |
attatactaaaaataacaaataacatgttttattctatcaaccaaattttcgaaaagaaaaaaaaaaaatactatcacatatttactaaccgttccaaga |
3298546 |
T |
 |
| Q |
107 |
acatctcttttataaaagttacagacaatcatttacaaagaatattatctttactatgaactgaagccttatcaagttattgtatataggataattattt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3298545 |
acatctcttttataaaagttacagacaatcatttacaaagaatattatctttactatgaactgaagctttatcaagttattgtatataggataattattt |
3298446 |
T |
 |
| Q |
207 |
tgtaatattaacttattt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3298445 |
tgtaatattaacttattt |
3298428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University