View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_low_72 (Length: 240)
Name: NF14713_low_72
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 8166343 - 8166563
Alignment:
| Q |
1 |
attcacacgacattagttctatccaacatgaaagtaggtgtttagtcttccaatttactctagaactagaatgaagcaccatgataagaa-ttttttgtc |
99 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8166343 |
attcacacgacattacttctatccaacatgaaagtaggtgtttagtcttccaatttactctagaactagaatgaagcaccatgataagaatttttttgtc |
8166442 |
T |
 |
| Q |
100 |
tgttccatgataagattttgatatatcctcaatcaactattgatgtcaatttgaattatatttgcgcaaccaacttactcatacacattacttatatatt |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
8166443 |
tgttccatgataagattttg--atatcctcaatcaactattgatgtcaatttgaattatatttgcgcaaccaacttagtcatacacgttacttatatatt |
8166540 |
T |
 |
| Q |
200 |
aagaattaaatagccactgtggt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8166541 |
cagaattaaatagccactgtggt |
8166563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University