View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14713_low_78 (Length: 227)
Name: NF14713_low_78
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14713_low_78 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 32821622 - 32821843
Alignment:
| Q |
7 |
atatccaacacaatgaagatgttggaagctgcaattacaatgaagacaatccaaatgccacaatataaggcggtcagaggaaaaccaaatcaaggtggaa |
106 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32821622 |
atatccaacacagtgaagatgttggaagctgcaattgcaatgaagacaatcaaaatgccacaatataaggcggtcagaggaaaaccaaatcaaggtggaa |
32821721 |
T |
|
| Q |
107 |
tttccgacataaatatatgacccatccattgtttgaatggaaacaaaactttcagctactgctttcatatattaacgcttattttgaggtaaattatcgc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
32821722 |
tttccgacataaatatatgacccatccattgtttgaatggaaacaaaactttcagctactgctttcatatactaacgcttattttgaggtaaatgatcgc |
32821821 |
T |
|
| Q |
207 |
ctt-aatatacaatcctagttt |
227 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
32821822 |
cttaaatatacaatcctagttt |
32821843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University