View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14713_low_81 (Length: 220)

Name: NF14713_low_81
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14713_low_81
NF14713_low_81
[»] chr5 (3 HSPs)
chr5 (17-198)||(36883217-36883398)
chr5 (19-194)||(36893224-36893399)
chr5 (60-194)||(36903029-36903160)


Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 36883398 - 36883217
Alignment:
17 cagagaagcaaagaccgataagtgaagaaatggcaaaggcgtcgaatgcaggcttgccttctaatactggactaccttcatcggttgtgccaccaggtac 116  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||    
36883398 cagagaagcaaagaccgataagtgaagaaatggcaaaggcgtcaaatgcaggcttgccttctaatactggactgccttcatcggttgtgccgccaggtac 36883299  T
117 ttggcttgctgtggcgaaggaaacaccggctacaaggccagatacgacggagcaggattctgacgtgtcttttagccaactg 198  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36883298 ttggcttgctgtggcaaaggaaacaccggctacaaggccagatacgacggagcaggattctgacgtgtcttttagccaactg 36883217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 36893399 - 36893224
Alignment:
19 gagaagcaaagaccgataagtgaagaaatggcaaaggcgtcgaatgcaggcttgccttctaatactggactaccttcatcggttgtgccaccaggtactt 118  Q
    |||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||| || ||||||| ||| |||||||| ||||||||      
36893399 gagaagcagagaccgataagtgaagaaatggcaaagacatcgaatgcaggcttgccttctaataccggtctaccttgatcagttgtgccgccaggtacag 36893300  T
119 ggcttgctgtggcgaaggaaacaccggctacaaggccagatacgacggagcaggattctgacgtgtcttttagcca 194  Q
     |||||||||||| ||||||||||| ||||||||| ||||||| || ||||||||||| || ||||||||||||||    
36893299 cgcttgctgtggcaaaggaaacaccagctacaagggcagatacaacagagcaggattccgatgtgtcttttagcca 36893224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 194
Target Start/End: Complemental strand, 36903160 - 36903029
Alignment:
60 gaatgcaggcttgccttctaatactggactaccttcatcggttgtgccaccaggtacttggcttgctgtggcgaaggaaacaccggctacaaggccagat 159  Q
    ||||||||| ||||||||||||||||| ||||| |||   ||||| || |||||||||   |||| ||||| ||||||| |||| || |||||  | | |    
36903160 gaatgcaggattgccttctaatactggtctaccctca---gttgttccgccaggtactgcacttgttgtggtgaaggaagcaccagcgacaagcgcggct 36903064  T
160 acgacggagcaggattctgacgtgtcttttagcca 194  Q
    || || |||||||| ||||  |||| |||||||||    
36903063 acaaccgagcaggaatctgctgtgttttttagcca 36903029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University