View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14713_low_83 (Length: 213)

Name: NF14713_low_83
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14713_low_83
NF14713_low_83
[»] chr1 (1 HSPs)
chr1 (1-198)||(39620754-39620951)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 39620951 - 39620754
Alignment:
1 tatgagatgctaaatgatgcaagacctcgagtacttagaatttggaaatttcnnnnnnnnnnnnnnnnnnnntattgttcaaatgtaatcatattcaaca 100  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||                    ||||||||||||||||||||||||||||    
39620951 tatgagatgttaaatgatgcaagacctcgagtacttagaatttggaaatttcaaaaaacaaaatgacaaaaatattgttcaaatgtaatcatattcaaca 39620852  T
101 gtatttgttcaagaggtgtcagctgagtatcgaagatggactttgtaaaatgttcaataagagtataatacgatcattgtaaatctttgattaaaatt 198  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39620851 gtatttattcaagaggtgtcagctgagtatcgaagatggactttgtaaaatgttcaataagagtataatacgatcattgtaaatctttgattaaaatt 39620754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University